Bug fix: perfect match hits (no indels or mismatches) were skipped

[nh13]

No description provided.

[nh13]

Perhaps this tool should be removed, as newer versions of blast support SAM output?

[daviesrob]

blastn's SAM output seems very odd. When I try this query sequence:

>test
CTTGGTATTTACTCAAAGGAGTTGAAGACATGTCCACAAAAAAACCTGCACACAGATATTCATAGCAGCTTTATTCGTAA
TTGCCAAAACTTGAAAGCAACCAAGATACCCTTCAGTAGGTGAATGGAGAAATAAACTGTGGTACATCCAGATAATAGAA

against GCA_000001405.15_GRCh38_full_analysis_set.fna I get output like this:

@HD	VN:1.2	SO:coordinate	GO:reference
@SQ	SN:Query_1	LN:160
@PG	ID:0	VN:2.7.1+	CL:blastn -db GCA_000001405.15_GRCh38_full_analysis_set.fna -query /tmp/q -outfmt 17 	PN:blastn
chr9	0	Query_1	1	255	72373920H160M66020637H	*	0	0	*	*	AS:i:160	EV:f:2.21948e-78	NM:i:0	PI:f:100.00	BS:f:296.584
chr4	16	Query_1	1	255	18102142H29M2I60M1D70M172112252H	*	0	0	*	*	AS:i:94	EV:f:1.08505e-41	NM:i:3	PI:f:88.05	BS:f:174.705
[ ... rest of output snipped ... ]

So it's changed my query name from test to Query_1 and then used it as the reference instead. Meanwhile, it's taken the reference names from the blast database and used them as query names. I wonder if they really intended it to work that way?

Given that oddness, there is possibly some utility in keeping this script around even though it has its own problems (like it doesn't add any header lines).

[nh13]

@daviesrob try -outfmt "17 SR SQ". The SQ will include query sequence (bases), while SR will swap query and reference, making it as you'd expect with SAM (header lines, query). The issue I have seen is that the blastn header will only include the references to which there are mappings, not all references. I'd vote to remove the script as it isn't well tested, and really we should patch blast.

I'd be happy to patch blast, but I only see source tarballs.

[daviesrob]

Ah yes, that improves it. It still doesn't give the right query name, though.

I might add a note to its manual page to say there are better alternatives. I doubt many people use it given that you're the first to report a fairly obvious bug.